지원사업
학술연구/단체지원/교육 등 연구자 활동을 지속하도록 DBpia가 지원하고 있어요.
커뮤니티
연구자들이 자신의 연구와 전문성을 널리 알리고, 새로운 협력의 기회를 만들 수 있는 네트워킹 공간이에요.
초록· 키워드
오류제보하기
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
목차
등록된 정보가 없습니다.
참고문헌 (0)
참고문헌 신청함께 읽어보면 좋을 논문
논문 유사도에 따라 DBpia 가 추천하는 논문입니다. 함께 보면 좋을 연관 논문을 확인해보세요!
-
Agrobacterium tumefaciens A348에서 virE 프로모터의 활성
식물학회지
1991 .01
-
Analysis of the regulatory sequence of the virE promoter in Agrobacterium tumefaciens.
한국동물학회 학술대회
1996 .01
-
Mutational analysis of the vir-box in virE promoter of pTiA6
한국동물학회 학술대회
1994 .01
-
The role of putative -35 sequence in the virE gene expression of Agrobacterium tumefaciens
한국동물학회 학술대회
1997 .01
-
Mutational Analysis of the Role of vir-box in the Expression of the virE Gene
The Journal of Microbiology
1999 .09
-
NcoI Restriction Fragment Length Polymorphism of the Tumor Necrosis Factor (TNF$\alpha$) Promoter in Korean
한국동물학회 학술대회
1995 .01
-
Screening of Promoters from Metagenomic DNA and Their Use for the Construction of Expression Vectors
Journal of Microbiology and Biotechnology
2008 .01
-
프로모터 예측을 위한 다중 결정 모델 지능 시스템
한국생물정보시스템생물학회 학술대회
2003 .01
-
Characterization of the Promoter Controling the Stage-Specific Gene Expression of Bombyx mori
생명과학회지
2011 .10
-
Building the Frequency Profile of the Core Promoter Element Patterns in the Three ChromHMM Promoter States at 200bp Intervals: A Statistical Perspective
Genomics & informatics
2015 .01
-
Promoter effects of adeno-associated viral vector for transgeneexpression in the cochlea in vivo
Experimental and Molecular Medicine
2007 .01
-
A Novel Bi-directional Promoter Cloned from Melon and Its Activity in Cucumber and Tobacco
식물학회지
2008 .01
-
Transforming Capacity of the Plasmid Containing SV40 Promoter in NIH3T3 Fibroblast Cells
미생물학회지
1989 .03
-
Promoter Recognition by E. coli RNA Polymerase : Effects of α Subunit Interactions with Upstream DNA on Isomerization of the RNAP-Promoter Complex
한국미생물학회 학술대회논문집
2007 .05
-
유전자 프로모터 예측을 위한 Support Vector Machine의 응용 방법에 대한 연구
생명과학회지
2007 .05
-
Differential Expression of the Potato Proteinase Inhibitor II Promoter in Transgenic Tobacco
식물학회지
2000 .01
-
재조합 Corynebacterium glutamicum으로부터 헴첼 생산에 미치는 프로모터의 효과
한국미생물·생명공학회지
2019 .01
-
λPR 프로모터 열린복합체 형성에 미치는 DNA Melting 부위 염기서열의 영향
미생물학회지
1990 .03
-
Analysis of Hot Pepper Promoters and Gene Expression Regulation
한국유전체학회 Conference
2003 .01
-
The Best Combination of Agrobacterium tumefaciens Strains and Ti-plasmids for the Construction
한국동물학회 학술대회
1996 .01
이 논문의 저자 정보
최근 본 자료
댓글(0)
0